BBa_K1799000 1 BBa_K1799000 pLsrA-2 2015-08-05T11:00:00Z 2015-09-18T01:13:21Z This part was synthesized from E. coli genomic data retrieved via EcoGene. It is based on, but not identical to, a part created by the 2011 Tokyo Tech iGEM team: http://parts.igem.org/Part:BBa_K649100 Promoter for the E. coli LsrACDB operon. This promoter is repressed by LsrR, and derepressed by autoinducer 2 (AI-2) in the presence of LsrK. false false _2224_ 9151 19613 9 true Promoter begins with the start of its cAMP-CRP binding site and ends after the second key LsrR binding sequence. false Miranda Halle annotation2434485 1 cAMP-CRP binding site range2434485 1 1 21 annotation2434486 1 LsrR binding site range2434486 1 81 86 annotation2434487 1 LsrR binding site range2434487 1 94 102 BBa_K1799000_sequence 1 aattgtgatctattcgtcggaaatatgtgcaatgtccacctaaggttatgaacaaattaaaagcagaaatacatttgttcaaaactcacctgcaaaactgaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z