BBa_K1799008 1 BBa_K1799008 LsrC (modularization optimized) 2015-08-06T11:00:00Z 2015-09-18T05:16:06Z This part was synthesized, and is based on E. coli genomic data retrieved via EcoGene: http://www.ecogene.org/gene/EG13807 Gene for the C subunit of the LsrACDB transporter, present in E. coli on the LsrACDBFG operon. The C subunit is a permease protein in the transporter, which actively brings autoinducer 2 (AI-2) into the cell. The portion of the LsrACDBFG operon that codes for the AI-2 transporter consists of four open reading frames, which code for A, C, D, and B, respectively. Three of these ORFs overlap with one another: C overlaps with A, and its RBS is contained within the A subunit ORF, and D overlaps with C (although to a lesser extent), and its RBS is contained within the C subunit ORF. From a modularization standpoint, this creates an inefficiency because the wild type ORFs of the A and C subunits both contain functional RBSs, and in the case of the A subunit ORF, an ATG 4bp downstream. To reduce this inefficiency, we have created versions of each subunit ORF that are optimized for modularization. false false _2224_ 26720 19613 9 false This version of the open reading frame has been optimized for modularization via silent mutations of the LsrD RBS, as well as any segments of code sharing more than 83% homology with the Shine-Dalgarno sequence. It is otherwise identical to the wild type LsrC gene (http://parts.igem.org/Part:BBa_K1799004). false Michael Flanagan BBa_K1799008_sequence 1 atgctgaagtttattcagaacaaccgtgaaatcacggcactgctggcggtggtgctgctgtttgtattacccggttttctcgaccgccagtatttaagtgtgcaaacgctgaccatggtttatagcagcgcgcaaatcctgatcctgctggcaatgggcgcgacgctggtaatgcttacgcgcaatattgatgtttcagtgggttcgattaccggaatgtgcgcggtgctgttggggatgttactgaacgcaggatattcactacctgttgcttgtgtcgcgactttactgcttggtttgctcgcgggatttttcaacggtgtcctggtcgcgtggctaaagatccctgccattgttgccacccttggcacgttagggttgtacagaggcatcatgttgctgtggactggcggcaaatggattgaagggttacccgccgaactgaaacagctctccgccccgctgctgcttggcgtttcagcaattggttggttgacgataattctggtggcatttatggcctggctgctggcaaagacggcgtttggacgcagtttttatgccacgggcgataatttacagggcgctcgtcaactgggcgttcgtactgaagccattcgcattgtggcattttcgttgaacggctgcatggcggcactggcgggaattgtgtttgcttcgcagattggttttatccccaaccagaccggtaccgggctggagatgaaagcaattgcagcctgcgtgctgggcggcattagtttgctcggtggttccggtgcgatcattggtgcggtactcggcgcatggttcctgacgcagatcgatagcgtactggtgctgttgcgcattccggcatggtggaatgattttatcgcgggtctggttctgctggcggtgctggtgtttgatggacgcctgcgttgtgcgctggaacgtaatctacggcggcaaaaatatgcccgctttatgacgccaccgccatccgttaaacccgcttcgtcaggtaaaaagcgtgaagccgcataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z