BBa_K1799009 1 BBa_K1799009 LsrD (modularization optimized) 2015-08-06T11:00:00Z 2015-09-18T05:16:59Z This part was synthesized, and is based on E. coli genomic data retrieved via EcoGene: http://www.ecogene.org/gene/EG13808 Gene for the D subunit of the LsrACDB transporter, present in E. coli on the LsrACDBFG operon. The D subunit is a permease protein in the transporter, which actively brings autoinducer 2 (AI-2) into the cell. The portion of the LsrACDBFG operon that codes for the AI-2 transporter consists of four open reading frames, which code for A, C, D, and B, respectively. Three of these ORFs overlap with one another: C overlaps with A, and its RBS is contained within the A subunit ORF, and D overlaps with C (although to a lesser extent), and its RBS is contained within the C subunit ORF. From a modularization standpoint, this creates an inefficiency because the wild type ORFs of the A and C subunits both contain functional RBSs, and in the case of the A subunit ORF, an ATG 4bp downstream. To reduce this inefficiency, we have created versions of each subunit ORF that are optimized for modularization. false false _2224_ 26720 19613 9 false This version of the open reading frame has been optimized for modularization via silent mutations in segments of code sharing more than 83% homology with the Shine-Dalgarno sequence. It is otherwise identical to the wild type LsrD gene (http://parts.igem.org/Part:BBa_K1799005). false Michael Flanagan BBa_K1799009_sequence 1 atgcgtattcgctacggttgggaactggctcttgccgcactgctcgttattgagattgtcgcatttggtgcaattaacccgcgaatgttagatctcaatatgttgctgttcagcaccagtgactttatctgcattggcattgtcgccctaccgctaacgatggtgattgtcagtggcgggatcgatatttcgtttggttcgaccatcggcctctgcgccattgcattgggcgtactgtttcaaagtggtgtgccgatgccgctggcgatactcctgaccttactgctcggcgcattgtgcgggctgatcaacgccggattaattatctataccaaagttaacccgctggtgattacgcttggcacgctgtatctgtttgccggaagcgctctgctgctttccggtatggccggagcgacggggtacgaaggtattggtggattcccgatggcgtttacagatttcgctaacctggatgtgctgggactccccgttccgctgattatcttcctgatatgtctcctcgttttctggctctggctgcataaaacccatgccggacgtaatgtgtttttgattgggcaaagcccgcgcgtggcgctttatagcgcgattccagttaaccgtaccttatgtgcgctctatgccatgacggggctggcgtctgcggtcgccgctgtgctgctggtatcgtattttggttcagcacgttccgatctcggtgcgtcgtttctgatgcccgccatcaccgccgtggtgcttggcggggccaatatttatggtggttccggttccattatcggcaccgccattgcggttttattagtgggatatttgcaacaaggtttgcaaatggctggtgtgccaaatcaggtgtccagcgccctttccggtgcgctacttatcgtcgttgtcgtaggtcgttccgttagcctgcatcgccagcaaattaaagagtggctggcgcgtcgggccaataacccattgccatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z