BBa_K1799015 1 BBa_K1799015 pYeaR 2015-08-26T11:00:00Z 2015-08-27T03:20:08Z This part was synthesized from E. coli genomic data retrieved via EcoGene. Nitrate sensitive promoter false false _2224_ 26954 26954 9 false None false Will Shindel BBa_K1799015_sequence 1 ttcccatctataatcctccctgattcttcgctgatatggtgctaaaaagtaaccaataaatggtatttaaaatgcaaattatcaggcgtaccctgaaacg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z