BBa_K1799028 1 BBa_K1799028 RBS.2 2015-09-17T11:00:00Z 2015-09-18T03:10:39Z BBa_B0032 Part of the Synbiota parts kit. note BBa_B0032 with appended 5???stp codon + Kpn1 site false false _2224_ 9151 9151 9 false appended 5???stp codon + Kpn1 site false Ellen Jorgensen BBa_K1799028_sequence 1 tgagtacctcacacaggaaagtctaactcatggagtgtgtcctttcagat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z