BBa_K1800000 1 BBa_K1800000 Mambalgin-1 for E. coli 2015-08-24T11:00:00Z 2015-08-31T11:29:06Z Mambalgin-1 sequence (BBa_k1110003), RBS (BBa_j61101), lacI Promoter (BBa_R0011), MYC and 6xHis tag was copied from the pGAPZα vector sequence. This codes for the peptide Mambalgin-1, an analgesic. Mambalgin is a protein component of the venom of Dendroaspis polylepis, better known as the Black Mamba. Mambalgin-1 peptide that is a powerful analgesic that directly blocks pain transmission in the peripheral nervous system (Diochot et al, 2012) by targeting acid-sensing ion channels within nociceptors beneath the epidermis. Because Mambalgin acts on pain receptors within the skin rather than on opioid receptors in the brain, this peptide has great potential as a medication for pain treatment that is non-addicting and non-habit forming. Furthermore, recombinant purification of Mambalgin could assist in developing anti-venom without the attendant risk of harvesting venom directly from snakes. This part is designed for expression in E. coli. false false _2225_ 27447 27447 9 false For the design, we used assembly standard 10 and also included a start codon in the Mambalgin-1 cDNA sequence and had it synthesized with an RBS region, lacI promoter region, MYC epitome, and 6xHis tag for optimized expression in E. coli. false Laura Lee Irvin annotation2440929 1 lac O1 range2440929 1 3 19 annotation2440931 1 lac O1 range2440931 1 26 42 annotation2440933 1 BBa_J61101 range2440933 1 64 75 annotation2440936 1 6x His Tag range2440936 1 303 320 annotation2440932 1 -10 range2440932 1 43 48 annotation2440935 1 MYC Epitope range2440935 1 258 287 annotation2440928 1 BBa_R0011 range2440928 1 1 54 annotation2440930 1 -35 range2440930 1 20 25 annotation2440934 1 Mambalgin codon optimized for E. coli range2440934 1 84 254 BBa_K1800000_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatcatagaggaaagacaggaccctactagatgctcaaatgctatcagcatggtaaagttgtaacctgtcatcgcgatatgaagttttgctatcataacacggggatgccgtttcgtaacctgaaacttattctgcaagggtgctccagttcctgtagcgaaactgaaaacaacaagtgttgctccacggatcgctgtaataaagaacaaaaactcatctcagaagaggatctgaatagcgccgtcgaccatcaccatcatcatcat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z