BBa_K1800001 1 BBa_K1800001 Alpha-Factor Secretion Signal 2015-08-27T11:00:00Z 2015-09-01T03:19:02Z The coding sequence for this part was taken from the pGAPza pichia pastoris expression vector. The coding sequence for this part was taken from the pGAPza pichia pastoris expression vector. false false _2225_ 27433 27447 9 false This part was constructed with the alpha secretion signal coding sequence taken from a pGAPza vector. RFC 25 prefix and suffix were added to enable the creation of fusion proteins that can be secreted. false Laura Lee Irvin BBa_K1800001_sequence 1 atgagatttccttcaatttttactgctgttttattcgcagcatcctccgcattagctgctccagtcaacactacaacagaagatgaaacggcacaaattccggctgaagctgtcatcggttactcagatttagaaggggatttcgatgttgctgttttgccattttccaacagcacaaataacgggttattgtttataaatactactattgccagcattgctgctaaagaagaaggggtatctctcgagaagagagaggctgaagca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z