BBa_K1804002 1 BBa_K1804002 pNirB-Invasin 2015-09-17T11:00:00Z 2015-09-27T05:22:08Z The invasin gene from Yersinia is derived from http://parts.igem.org/Part:BBa_K299812 and the pNirB promoter is derived from Jayaraman et al., (1988). The nirB promoter of Escherichia coli: location of nucleotide sequences essential for regulation by oxygen, the FNR protein and nitrite. Molecular Microbioiogy (1988) 2(4), 527-530 In this construct, the invasin gene from Yersina is placed under the expression of the anaerobic-sensitive promoter pNirB from Escherichia coli. false false _2229_ 26010 25841 9 false - false Tan Yi Han annotation2476440 1 BBa_B0032 range2476440 1 75 87 annotation2476439 1 nirB promoter range2476439 1 3 74 BBa_K1804002_sequence 1 gaattcgcggccgcttctagagcattaaggagtataaaggtgaatttgatttacatcaataagcggggttgctgaatcgttaaggtaggcggtatcacacaggaaagtactagat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z