BBa_K1807015 1 Adapter Bi This device allows for the IPTG-inducible expression of lacZα peptide which in the presence of 2015-09-17T11:00:00Z 2015-09-18T05:21:16Z Coding sequence of lacZ alpha peptide comes from Escherichia coli. - true false _2232_ 16983 16983 9 Not in stock false - false Ivan Gyulev annotation2470684 1 BBa_R0011 range2470684 1 1 55 annotation2470716 1 RBS range2470716 1 62 73 annotation2470715 1 BBa_B0034 range2470715 1 62 73 annotation2470846 1 Terminator range2470846 1 274 403 annotation2470878 1 SmaI Site range2470878 1 269 274 annotation2470845 1 BBa_B0015 range2470845 1 274 403 annotation2470827 1 LacZ-alpha peptide range2470827 1 83 268 annotation2470869 1 SmaI Site range2470869 1 77 82 annotation2470826 1 BBa_E0038 range2470826 1 83 268 annotation2470714 1 pLac range2470714 1 1 55 BBa_K1807015_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatacgagaaagaggagaaataccccgggatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctaataacccgggccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z