BBa_K1808006 1 BBa_K1808006 CYB5 HIS from Artemisia annua 2015-09-15T11:00:00Z 2015-09-16T11:07:37Z Artemisia annua This is the coding region of the CYB5 HIS gene from Artemisia annua with added biobrick suffix and prefix in a pSB1C3 plasmid backbone and a 6 HIS TAG. This part is an element of TCD iGEM 2015 set of parts for the synthesis of the anti-malarial drug precursor dihydroartemisinic acid in E. coli. The CYB5 was used by our team to increase the efficiency of the rate limiting step of Cytochrome P450 which catalyses the conversion of amorphadiene to artemisinic alcohol to artemisinic aldehyde and finally to artemisinic acid. false false _2233_ 26124 26124 9 false his part is codon optimised for BioBrick 3A assembly and expression in E. coli cells as well as protein purification false Remsha Afzal annotation2461254 1 CYB5 range2461254 1 1 429 annotation2461257 1 6 HIS range2461257 1 409 426 BBa_K1808006_sequence 1 atggcgtcagatcctaagaattttgtattcgatgacatttcaaagcataacaaaacaaaagattgttggctcatcattgatggtaaagtctatgacgtcacgccattcatggaagatcacccaggtggagatgaagttttgttagcagctactggaaaagatgctaccgacgatttcgaagatgtcggacactcggacgatgcacgtgaaatgatgcacaaatactatattggagaagtggataaagctaccgtgcccaaaaaacgcgcatatgtgccgccagcggatcgccactacaatccggacaaaacccaggattttattgtcaaaattctgcaatttcttgttccattggtgatcttggggttagcctttgccgtgcgcagctacaccaaagaacgtagtgctcatcaccatcaccatcactaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z