BBa_K1809006 1 BBa_K1809006 MaAFP 2015-08-02T11:00:00Z 2016-01-27T10:33:14Z Taken from the ocean pout Macrozarces americanus. Pubmed ID: 3840475 Antifreeze proteins (AFPs) are molecules with the unique property of binding and shaping ice crystals, preventing their growth into relatively large cell-lysing structures (Davies and Sykes 1997). They exhibit a property known as thermal hysteresis, whereby their activity decreases the freezing point of water without changing the melting point. This property allows organisms which produce AFPs to survive colder conditions. Additionally, AFPs have shown biolfilm inhibbiting properties, potetnially giving them uses in medical applications. false false _2234_ 4206 26152 9 false Codon optimized the sequence for E. coli and to minimize repetitive sequences; removed illegal restriction sites. false Edward Dring annotation2433990 1 MaAFP range2433990 1 1 264 BBa_K1809006_sequence 1 atgaaaagcgtgattcttacgggcctgctgtttgtgttactgtgtgttgatcatatgaccgccagccagtccgtcgtcgctacgcagctgatcccaatcaatactgccctgacgcccgcgatgatggaaggaaaggtgaccaatccaattgggattccgttcgctgaaatgtcacagatcgtgggcaaacaagtgaacaccccggtggcgaaaggtcagacgctgatgcccaacatggtaaaaacttatgttgccgggaaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z