BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K1809026 1 BBa_K1809026 Const. Promoter-RBS-TmAFP-DT 2015-08-25T11:00:00Z 2015-08-26T09:22:04Z Composite of parts BBa_J23119 and BBa_K1809016 This part contains the constitutive promoter BBa_J23119, an RBS, Tenebrio molitor antifreeze protein (TmAFP), and a double terminator. It produces a high level of expression of the antifreeze protein. false false _2234_ 24831 24831 9 false Used a strong promoter to produce high levels of expression of TmAFP. false David Morgan component2438139 1 BBa_J23119 component2438142 1 BBa_K1809025 component2438143 1 BBa_B0010 component2438141 1 BBa_B0034 component2438145 1 BBa_B0012 annotation2438145 1 BBa_B0012 range2438145 1 515 555 annotation2438141 1 BBa_B0034 range2438141 1 44 55 annotation2438143 1 BBa_B0010 range2438143 1 427 506 annotation2438139 1 BBa_J23119 range2438139 1 1 35 annotation2438142 1 BBa_K1809025 range2438142 1 62 418 BBa_K1809025 1 BBa_K1809025 TmAFP 2015-08-25T11:00:00Z 2016-01-27T10:36:08Z Taken from the mealworm beetle Tenebrio molitor. Pubmed ID: 17443386 Antifreeze proteins (AFPs) are molecules with the unique property of binding and shaping ice crystals, preventing their growth into relatively large cell-lysing structures (Davies and Sykes 1997). They exhibit a property known as thermal hysteresis, whereby their activity decreases the freezing point of water without changing the melting point. This property allows organisms which produce AFPs to survive colder conditions. Additionally, AFPs have shown biolfilm inhibiting properties, potentially giving them uses in medical applications. false false _2234_ 4206 24831 9 false Codon optimized the sequence for E. coli and to minimize repetitive sequences; removed illegal restriction sites. false David Morgan BBa_J23119 1 BBa_J23119 constitutive promoter family member 2006-08-23T11:00:00Z 2015-08-31T04:08:40Z Overlap extension of synthetic oligonucleotides Released HQ 2013 Later false true _52_ 0 483 95 In stock false N/A true John Anderson BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1809026_sequence 1 ttgacagctagctcagtcctaggtataatgctagctactagagaaagaggagaaatactagatggcgtttaaaacctgtgcccttaccaagaattggcttgtgattgctgttattgtaatgtgcctgtgcgcagaatataactgtcagtgcaccggtggcgcggattgtacgtcctgcaccgccgcctgtacgggatgcggcaattgcccaaatgccgcgacctgcacggacagccagaattgtgtgactgcggccacttgcacacgcagtaccaagtgcaacacggcccgtacgtgcacaaatagcaaagactgcttcgaggcggcgacctgtacagattctaccaactgctacaaggcgaccacctgcacaattcaacaggacgtccccgatattcgttttttttattgtcagcagtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_K1809025_sequence 1 atggcgtttaaaacctgtgcccttaccaagaattggcttgtgattgctgttattgtaatgtgcctgtgcgcagaatataactgtcagtgcaccggtggcgcggattgtacgtcctgcaccgccgcctgtacgggatgcggcaattgcccaaatgccgcgacctgcacggacagccagaattgtgtgactgcggccacttgcacacgcagtaccaagtgcaacacggcccgtacgtgcacaaatagcaaagactgcttcgaggcggcgacctgtacagattctaccaactgctacaaggcgaccacctgcacaattcaacaggacgtccccgatattcgttttttttattgtcagcag BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23119_sequence 1 ttgacagctagctcagtcctaggtataatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z