BBa_K1809027 1 BBa_K1809027 LpAFP 2015-08-25T11:00:00Z 2016-01-27T10:36:21Z Taken from the rye grass Lolium perenne. Pubmed ID: 21457707 Antifreeze proteins (AFPs) are molecules with the unique property of binding and shaping ice crystals, preventing their growth into relatively large cell-lysing structures (Davies and Sykes 1997). They exhibit a property known as thermal hysteresis, whereby their activity decreases the freezing point of water without changing the melting point. This property allows organisms which produce AFPs to survive colder conditions. Additionally, AFPs have shown biolfilm inhibiting properties, potentially giving them uses in medical applications. false false _2234_ 4206 24831 9 false Codon optimized the sequence for E. coli and to minimize repetitive sequences; removed illegal restriction sites. false David Morgan BBa_K1809027_sequence 1 atggatgaacaaccgaatactatttctggcagcaacaataccgtgcggtcgggctccaaaaacgtgttggcaggtaacgacaacacggtaattagcggtgacaacaacagcgtcagtgggtcaaataacactgttgtctctggtaatgataacacggtcacgggcagcaaccacgttgtttcaggtaccaaccacattgttaccgacaataataataacgtaagtggtaatgataataacgtttccggctcattccataccgtgagcggaggtcataataccgtgtccggctcaaataacaccgtcagcggctcgaatcacgtggtttcgggctccaataaagtggtgaccgatgcctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z