BBa_K1809029 1 BBa_K1809029 MoAFP 2015-08-25T11:00:00Z 2016-01-27T10:36:48Z Taken from the longhorn sculpin Myoxocephalus octodecemspinosus. Pubmed ID: 11136728 Antifreeze proteins (AFPs) are molecules with the unique property of binding and shaping ice crystals, preventing their growth into relatively large cell-lysing structures (Davies and Sykes 1997). They exhibit a property known as thermal hysteresis, whereby their activity decreases the freezing point of water without changing the melting point. This property allows organisms which produce AFPs to survive colder conditions. Additionally, AFPs have shown biolfilm inhibiting properties, potentially giving them uses in medical applications. false false _2234_ 4206 24831 9 false Codon optimized the sequence for E. coli and to minimize repetitive sequences; removed illegal restriction sites. false David Morgan BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_J23119 1 BBa_J23119 constitutive promoter family member 2006-08-23T11:00:00Z 2015-08-31T04:08:40Z Overlap extension of synthetic oligonucleotides Released HQ 2013 Later false true _52_ 0 483 95 In stock false N/A true John Anderson BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_K1809030 1 BBa_K1809030 Const. Promoter-RBS-MoAFP-DT 2015-08-25T11:00:00Z 2015-08-26T09:32:06Z Composite of parts BBa_J23119 and BBa_K1809036 This part contains the constitutive promoter BBa_J23119, an RBS, Myoxocephalus octodecemspinosus antifreeze protein (MoAFP), and a double terminator. It produces a high level of expression of the antifreeze protein. false false _2234_ 24831 24831 9 false Used a strong promoter to produce high levels of expression of MoAFP. false David Morgan component2438163 1 BBa_B0034 component2438164 1 BBa_K1809029 component2438161 1 BBa_J23119 component2438165 1 BBa_B0010 component2438167 1 BBa_B0012 annotation2438167 1 BBa_B0012 range2438167 1 287 327 annotation2438164 1 BBa_K1809029 range2438164 1 62 190 annotation2438161 1 BBa_J23119 range2438161 1 1 35 annotation2438163 1 BBa_B0034 range2438163 1 44 55 annotation2438165 1 BBa_B0010 range2438165 1 199 278 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1809029_sequence 1 atggacgcaccggccaaagcagccgcgaaaacggcggcggatgccaaggcagccgcggcgaaaaccgccgcagatgctcttgcagccgctaataaaacggcagctgccgcgaaagccgcagctaaataa BBa_B0034_sequence 1 aaagaggagaaa BBa_K1809030_sequence 1 ttgacagctagctcagtcctaggtataatgctagctactagagaaagaggagaaatactagatggacgcaccggccaaagcagccgcgaaaacggcggcggatgccaaggcagccgcggcgaaaaccgccgcagatgctcttgcagccgctaataaaacggcagctgccgcgaaagccgcagctaaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23119_sequence 1 ttgacagctagctcagtcctaggtataatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z