BBa_K1809035 1 BBa_K1809035 IAFGP 2015-08-25T11:00:00Z 2015-08-26T09:49:51Z Taken from the tick Ixodes scapularis. Pubmed ID: 20739755 Antifreeze proteins (AFPs) are molecules with the unique property of binding and shaping ice crystals, preventing their growth into relatively large cell-lysing structures (Davies and Sykes 1997). They exhibit a property known as thermal hysteresis, whereby their activity decreases the freezing point of water without changing the melting point. This property allows organisms which produce AFPs to survive colder conditions. Additionally, AFPs have shown biolfilm inhibiting properties, potentially giving them uses in medical applications. false false _2234_ 24831 24831 9 false Codon optimized the sequence for E. coli and to minimize repetitive sequences; removed illegal restriction sites. false David Morgan BBa_K1809035_sequence 1 atgacaacattattgcgtttaacgattcttatcgttgccgtggcaggcgtattggggagttctaaacgtgcagcacgtgctgctactcctgcaacagcagctacaccggcaactccagctacggctgctaccccagccattgcagcgactccagccacagcagcaacgcctgcgacagcagcgacgccagctcgtaaggcacgtgcagcgacacctgcaactccggcaacgcctgcaacagcagccacgccagcgactgcggcaacataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z