BBa_K1809999 1 BBa_K1809999 Const. Promoter-RBS-BrAFP-DT 2015-08-03T11:00:00Z 2015-08-26T09:14:18Z Taken from the Atlantic herring Clupea harengus. Pubmed ID: 9521729 Antifreeze proteins (AFPs) are molecules with the unique property of binding and shaping ice crystals, preventing their growth into relatively large cell-lysing structures (Davies and Sykes 1997). They exhibit a property known as thermal hysteresis, whereby their activity decreases the freezing point of water without changing the melting point. This property allows organisms which produce AFPs to survive colder conditions. Additionally, AFPs have shown biolfilm inhibiting properties, potentially giving them uses in medical applications. true false _2234_ 24831 24831 9 Not in stock false Codon optimized the sequence for E. coli and to minimize repetitive sequences; removed illegal restriction sites. false David Morgan BBa_K1809999_sequence 1 atgatgctgacggtctccctgctggtgtgcgctatcgttgccttgacacgcgctgcggacgaatgtccgaccgactggaaaatgttcaacggccgttgctttctgtttaacccgctgcaactgcattgggcagacgctcaggagtcctgtatgaaagaaggtgctaacctggccagtattcatagccttgaggagtctacttttgtgaaagagctcacttccgccgacttgattccgagctggattggcggcaccgattgtcaggtgagtacgcgctggttttggatggatagtacaagtatggattacgcagattggtgcgcagctcagccggatacaacactgaccgaatgttgcattcaaatgaatgtcggtatcggcaaatgctggaacgatactccgtgcacccatctgcacagcagtatttgtgctaagcccctgaaatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z