BBa_K1810001 1 BBa_K1810001 Repeating QSP Chain with HlyA secretion Tag 2015-09-12T11:00:00Z 2015-09-15T07:05:28Z The sequence for QSP was designed de novo, as codon optimization for E. coli was taken into account during its construction. The sequence for the OmpC promoter was obtained from the 2011 Missouri iGEM team (BBa_R0082), while the HlyA secretion tag sequence was obtained from the 2011 Brazil-France iGEM team (BBa_K554002). Both of these sequences are naturally found in E. coli, although the HlyA secretion system naturally exists only in pathogenic strains. QSP is a tripeptide drug that can inhibit the glucose reuptake pathway of the SGLT1 and SGLT2 membrane proteins of the Kidneys. This sequence codes for a repeated sequence of three sets of QSP. The string of tripeptides is fused with the HlyA secretion tag, which can be used in tandem with the HlyB and HlyD membrane proteins to secret the desired protein to the extracellular space of an E. coli cell. Once outside the cell, the string of peptides was to be cleaved by a proline iminopeptidase that is bound on the membrane of the E. coli cell, and thus ultimately produces the pharmacologically-active tripeptides. The coding sequence is placed under the OmpC promoter; this promoter is activated by phosphorylated OmpR, the concentration of which increases as extracellular osmolarity increased. Therefore, this system can be induced under conditions of high glucose in the cell environment, and therefore work to lower the level of glucose in the body acting through the kidneys. false false _2235_ 26456 26375 9 false The Hly secretion system has the added requirement that is can only transport unfolded peptide sequence through the membrane; because of this, the string of tripeptides had to be limited in size in order to ensure that folding would not occur and prevent secretion. false annotation2457998 1 BBa_B0030 range2457998 1 109 123 annotation2457049 1 BBa_R0082 range2457049 1 1 108 annotation2458000 1 BBa_B1002 range2458000 1 394 427 annotation2458001 1 His Tag range2458001 1 133 150 annotation2457999 1 Tripeptides range2457999 1 151 177 annotation2457051 1 BBa_K1166002 range2457051 1 178 394 BBa_K1810001_sequence 1 tcccttgcatttacattttgaaacatctatagcgataaatgaaacatcttaaaagttttagtatcatattcgtgttggattattctgcatttttggggagaatggactattaaagaggagaaatactagatgcatcatcaccatcaccatcagagtccgcagagcccgcaaagtccgggcggtggtggcagcggtggtggcggctctttagcctatggaagtcagggtgatcttaatccattaattaatgaaatcagcaaaatcatttcagcagcaggtagcttcgatgttaaagaggaaagaaccgcagcttctttattgcagttgtccggtaatgccagtgatttttcatatggacggaactcaataaccctgaccacatcagcataataacgcaaaaaaccccgcttcggcggggttttttcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z