BBa_K1810003 1 BBa_K1810003 Optimized Melittin 2015-09-14T11:00:00Z 2016-02-03T10:47:47Z The original sequence is taken from Apis mellifera; however, this sequence has been optimized for E. coli. Melittin is an antimicrobial peptide found in the venom of Apis mellifera. It works by aggregating in the membrane of a bacteria cell and forming a pore, ultimately lysing the cell. An original sequence for melittin in the registry can be found in the BBa_K1382000 BioBrick; however, this sequence was taken directly from Apis Mellifera. In this biobrick, the sequence for melittin has been optimized for E. coli. false false _2235_ 4206 26375 9 false The sequence was designed to use the codons that are preferred in E. coli. false annotation2457058 1 Melittin range2457058 1 1 90 BBa_K1810003_sequence 1 atgggtattggtgcggttctgaaagttctgaccaccggtctgccggcgctgatctcttggatcaaacgtaaacgtcagcagggttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z