BBa_K1811222 1 BBa_K1811222 codon optimized CUP1 2015-08-25T11:00:00Z 2015-08-26T08:34:02Z The CUP1 gene comes from NCBI ID 856450 and is native to S. cerevisiae. The gene sequence was then codon optimized for E. coli tRNA abundance. Metallothionein is a heavy metal binding protein native to S. cerevisiae that can bind up to 11 copper atoms. This part contains the gene sequence for CUP1 that has been codon optimized for E. coli tRNA abundance. false false _2236_ 20146 20146 9 false In making a G Block for this gene to be synthesized, a 20 bp overlap with the plasmid pSB1C3 needed to be added to the ends of the sequence. false Samuel Keating BBa_K1811222_sequence 1 atgtttagcgagctgatcaacttccagaatgaagggcacgagtgtcaatgccagtgcggcagttgcaagaacaacgaacagtgtcagaaatcctgctcctgtccgaccggctgtaacagtgacgataaatgcccatgtgggaacaaatccgaagagacgaaaaaaagttgctgctcaggcaaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z