BBa_M45090 1 BBa_M45090 CUP1 2014-04-14T11:00:00Z 2015-05-08T01:14:08Z Test Test false false _1855_ 0 20938 9 Not in stock false Test false Yonas Kidane annotation2372752 1 Stop Codon range2372752 1 184 186 annotation2372751 1 Start Codon range2372751 1 1 3 BBa_K1811777 1 BBa_K1811777 CUP1 copper resistance gene with RBS and promoter 2015-07-28T11:00:00Z 2015-08-26T08:34:45Z S. Cerevisiae gene CUP1 - NCBI ID 856450 Metallothionein is a copper binding protein native to S. cerevisiae that gives cells resistance to toxicity by binding 11 copper atoms. It prevents copper from reacting to form toxic molecules when bound and detoxifies free radicals. The part contains the metallothionein gene CUP1, a strong constituitive promoter (BBa_J23100), and an RBS (BBa_B0034). false false _2236_ 20146 20146 9 false Sequence had to be prepared to be compatible with Gibson assembly after being cut from a G block. false Samuel Keating component2438103 1 BBa_J23100 component2438108 1 BBa_M45090 component2438105 1 BBa_B0034 annotation2438108 1 BBa_M45090 range2438108 1 62 247 annotation2438103 1 BBa_J23100 range2438103 1 1 35 annotation2438105 1 BBa_B0034 range2438105 1 44 55 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0034_sequence 1 aaagaggagaaa BBa_M45090_sequence 1 atgttcagcgaattaattaacttccaaaatgaaggtcatgagtgccaatgccaatgtggtagctgcaaaaataatgaacaatgccaaaaatcatgtagctgcccaacggggtgtaacagcgacgacaaatgcccctgcggtaacaagtctgaagaaaccaagaagtcatgctgctctgggaaatga BBa_K1811777_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaatactagatgttcagcgaattaattaacttccaaaatgaaggtcatgagtgccaatgccaatgtggtagctgcaaaaataatgaacaatgccaaaaatcatgtagctgcccaacggggtgtaacagcgacgacaaatgcccctgcggtaacaagtctgaagaaaccaagaagtcatgctgctctgggaaatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z