BBa_K1813037 1 BBa_K1813037 ptac and RBS 2015-09-10T11:00:00Z 2015-09-18T07:18:03Z Registry ptac RBS false false _2238_ 25865 12892 9 false NA false UBC iGEM 2015 component2449457 1 BBa_K864400 component2449459 1 BBa_B0034 annotation2449457 1 BBa_K864400 range2449457 1 1 61 annotation2449459 1 BBa_B0034 range2449459 1 70 81 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K864400 1 BBa_K864400 Ptac, trp & lac regulated promoter 2012-09-24T11:00:00Z 2015-05-08T01:13:37Z Created from oligos ordered from SigmaAldrich. Oligo sequences: Ptac+ AATTCGCGGCCGCTTCTAGAGGAGCTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTA Ptac- CTAGTAAATTGTTATCCGCTCACAATTCCACACATTATACGAGCCGATGATTAATTGTCAACAGCTCCTCTAGAAGCGGCCGCG Released HQ 2013 The Ptac promoter is a functional hybrid promoter, derived from the trp and lac promoters, that are regulated by trp and lac [1]. This part also exist together with lacI, part [[Part:BBa_K180000|BBa_K180000]] [1] Proc. Natl. Acad. Sci. USA, Vol. 80, pp. 21-25 false false _1124_ 0 9827 9 In stock false Oligos ordered from SigmaAldrich were annealed to form a double stranded DNA segment, ready to be ligated into any BioBrick backbone. false Erik Lundin annotation2197238 1 -10 range2197238 1 29 33 annotation2197237 1 -35 range2197237 1 7 12 annotation2197236 1 Ptac range2197236 1 1 40 annotation2197240 1 lacO1 site range2197240 1 36 61 BBa_B0034_sequence 1 aaagaggagaaa BBa_K1813037_sequence 1 gagctgttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaatttactagagaaagaggagaaa BBa_K864400_sequence 1 gagctgttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z