BBa_K1819000 1 NdeI+E0040 GFP coding sequence with an N-terminal linker 2015-09-12T11:00:00Z 2015-09-16T07:11:11Z GFP coding sequence source is BBa_E0040 (http://parts.igem.org/Part:BBa_E0040) Designed by Brasil-USP team, BBa_K1819000 is a GFP coding sequence with an N-terminal linker, which is 5???-flanked by NdeI restriction site. It allows to characterize protein expression and secretion, and may serve to other IGEM teams that would like to express a chimera C-terminally attached to GFP, which exhibits bright green fluorescence when exposed to light in the blue to ultraviolet range. Such non-usual restriction site, NdeI restriction site, was placed for cloning purposes that lead to expression of recombinant protein with no additional amino acid residue(s) between its coding sequence and the fused N-terminal tag. false false _2244_ 21190 21190 9 false As a design consideration we highlight that we chose to add the NdeI restriction site to a GFP coding sequence to avoid any additional amino acid residue between coding sequence and the fused N-terminal tag. false Lais Ribovski annotation2453404 1 GFP E0040 range2453404 1 31 750 annotation2462935 1 binding range2462935 1 7 30 annotation2453668 1 NdeI site range2453668 1 1 6 BBa_K1819000_sequence 1 catatgggcggaggttctggaggagggagcatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcacatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z