BBa_K1820000 1 p1997 P335-&#934;31 inducible middle promoter 2015-09-15T11:00:00Z 2015-09-17T11:14:48Z add add false false _2245_ 25667 25667 9 false add false Thomas Overbeck annotation2466377 1 Transcription Start Site B range2466377 1 185 185 annotation2466373 1 Transcription Start Site A range2466373 1 144 144 annotation2466376 1 -10 Region B range2466376 1 172 177 annotation2466375 1 -10 Region A range2466375 1 132 137 annotation2466374 1 BamHI range2466374 1 1 6 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1820001 1 BBa_K1820001 P335-&#934;31 inducible middle promoter + RBS 2015-09-15T11:00:00Z 2015-09-18T02:12:04Z Add Add false false _2245_ 25667 25667 9 false Add false Thomas Overbeck component2461172 1 BBa_K1820000 component2461174 1 BBa_B0034 annotation2461172 1 BBa_K1820000 range2461172 1 1 245 annotation2461174 1 BBa_B0034 range2461174 1 254 265 BBa_B0034_sequence 1 aaagaggagaaa BBa_K1820000_sequence 1 ggatccgtgtcacataactgagcgccaatactttagaaagagaagagcaatacttgagaagtatgatgagatatgtgacggcttctggtaatttgtcaccttttgggcgaaaactgacaagataaatgttgtattatagtatcatcaaataaaacaaataaagccagcggatatattctgttggctttttgtgtggagaaagtgaggtgacctcccatagcattacgtgctgaccgtactggtgc BBa_K1820001_sequence 1 ggatccgtgtcacataactgagcgccaatactttagaaagagaagagcaatacttgagaagtatgatgagatatgtgacggcttctggtaatttgtcaccttttgggcgaaaactgacaagataaatgttgtattatagtatcatcaaataaaacaaataaagccagcggatatattctgttggctttttgtgtggagaaagtgaggtgacctcccatagcattacgtgctgaccgtactggtgctactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z