BBa_K1820010 1 BBa_K1820010 CP44 2015-09-15T11:00:00Z 2015-09-16T11:29:58Z Add Add false false _2245_ 25686 25686 9 false Add false Alex Torgesen annotation2474725 1 cp44 range2474725 1 1 58 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1820013 1 BBa_K1820013 CP44 + RBS 2015-09-15T11:00:00Z 2015-09-16T09:07:22Z Add Add true false _2245_ 25686 25686 9 false Add false Alex Torgesen component2461424 1 BBa_B0034 component2461422 1 BBa_K1820010 annotation2461424 1 BBa_B0034 range2461424 1 68 79 annotation2461422 1 BBa_K1820010 range2461422 1 1 59 BBa_B0034_sequence 1 aaagaggagaaa BBa_K1820010_sequence 1 catcgggtagtttattcttgacaattaagtagagcctgatataatagttcagtactgtt BBa_K1820013_sequence 1 catcgggtagtttattcttgacaattaagtagagcctgatataatagttcagtactgtttactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z