BBa_K182004 1 BBa_K182004 Lambda CI promoter (BBa_R0051) with a point mutation in -35 region. 2009-08-12T11:00:00Z 2015-05-08T01:11:06Z BBa_R0051 The cI regulated promoter is based on the pR promoter from bacteriophage lambda. The promoter has two DNA binding sites for lambda cI repressor BBa_C0051. cI binding results in repression of transcription. This particular promoter has got a point mutation ( C instead of T) in the -35 region of the promoter binding site. false false _279_ 0 3989 9 Not in stock false This part was used as an upstream part to construct the Biobruck BBa_K182005 false MD. RISAT UL HAQUE, Daniel J. Leirer annotation2017253 1 BBa_K182004 range2017253 1 1 49 annotation2017255 1 -35 range2017255 1 15 20 annotation2017257 1 OR2 range2017257 1 1 19 annotation2017258 1 OR1 range2017258 1 25 42 annotation2017259 1 Point Mutation range2017259 1 15 15 annotation2017256 1 -10 range2017256 1 37 43 BBa_K182004_sequence 1 taacaccgtgcgtgctgactattttacctctggcggtgataatggttgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z