BBa_S03518 1 BBa_S03518 B0034:C0040 2006-07-23T11:00:00Z 2015-05-08T01:14:24Z Released HQ 2013 false false _58_ 0 1061 58 In stock true true Azeem Kaka component2243681 1 BBa_B0034 component2243685 1 BBa_C0040 annotation2243685 1 BBa_C0040 range2243685 1 19 703 annotation2243681 1 BBa_B0034 range2243681 1 1 12 BBa_K182005 1 BBa_K182005 TetR regulated by CI operator (RBS+, Term-) with LVA tag 2009-08-12T11:00:00Z 2015-05-08T01:11:06Z BBa_K182004 , BBa_S03518 This is a part using the biobrick BBa_K182004 as the upstream part and BBa_S03518 as the downstream part. BBa_K182004 is a cI regulated promoter. The promoter has two binding sites for the cI repressor and is repressed when it binds.It is identical to BBa_R0051 apart from a point mutation in the -35 promoter binding region(15th base is C instead of T). BBa_S03518 is a TetR protein with a Ribosome Binding site upstream and an LVA tag attached to its end. TetR binds to TetR regulated promoters such as BBa_R0040. aTc (anhydrotetracycline) binds to TetR causing it to be released from the promoter and reintroducing transcription. This part comes without a terminator. false false _279_ 0 3989 9 It's complicated true BBa_K182004 was used as an upstream part and BBa_S03518 as a downstream part. false MD. RISAT UL HAQUE, Daniel J. Leirer component2246499 1 BBa_S03518 component2246487 1 BBa_K182004 annotation2246487 1 BBa_K182004 range2246487 1 1 49 annotation2246499 1 BBa_S03518 range2246499 1 58 760 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K182004 1 BBa_K182004 Lambda CI promoter (BBa_R0051) with a point mutation in -35 region. 2009-08-12T11:00:00Z 2015-05-08T01:11:06Z BBa_R0051 The cI regulated promoter is based on the pR promoter from bacteriophage lambda. The promoter has two DNA binding sites for lambda cI repressor BBa_C0051. cI binding results in repression of transcription. This particular promoter has got a point mutation ( C instead of T) in the -35 region of the promoter binding site. false false _279_ 0 3989 9 Not in stock false This part was used as an upstream part to construct the Biobruck BBa_K182005 false MD. RISAT UL HAQUE, Daniel J. Leirer annotation2017257 1 OR2 range2017257 1 1 19 annotation2017255 1 -35 range2017255 1 15 20 annotation2017256 1 -10 range2017256 1 37 43 annotation2017253 1 BBa_K182004 range2017253 1 1 49 annotation2017258 1 OR1 range2017258 1 25 42 annotation2017259 1 Point Mutation range2017259 1 15 15 BBa_C0040 1 tetR tetracycline repressor from transposon Tn10 (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999) Released HQ 2013 Coding region for the TetR protein without the Ribosome Binding Site. Modified with an LVA tail for rapid degradation of the protein and faster fall time for the emission. TetR binds to the pTet regulator (BBa_R0040). aTc (anhydrotetracycline) binds to TetR and inhibits its operation.</P> false true _1_ 0 24 7 In stock false References (unparsed) here: <p>Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). </P> <p> Lutz R, Bujard H., Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. PMID: 9092630 </p> <P> References (unparsed) here: <p>Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). </P> <p> Lutz R, Bujard H., Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. PMID: 9092630 </p> <P>BBa_C0040 TetR Protein is based on the TetR sequence from Elowitz's repressilator. It has been modified to include a rapid degradation LVA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA. <P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman. annotation23330 1 SsrA range23330 1 621 654 annotation2213989 1 Help:Barcodes range2213989 1 661 685 annotation23329 1 tetR range23329 1 4 620 BBa_B0034_sequence 1 aaagaggagaaa BBa_C0040_sequence 1 atgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac BBa_S03518_sequence 1 aaagaggagaaatactagatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac BBa_K182005_sequence 1 taacaccgtgcgtgctgactattttacctctggcggtgataatggttgctactagagaaagaggagaaatactagatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac BBa_K182004_sequence 1 taacaccgtgcgtgctgactattttacctctggcggtgataatggttgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z