BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I751502 1 BBa_I751502 plux-lac hybrid promoter 2007-10-24T11:00:00Z 2015-08-31T04:08:06Z sense TWO INPUTS, activation by AHL and repression by LacI. false false _151_ 0 2188 9 Not in stock false Compared with existing BioBrick hybrid promoter R0065, this promoter is different in that its sequence is much shorter with lux box and -35 region overlapping, and that it is repressed by LacI, not cI. Also, the output is clearly detected as shown in Fig. 3. false Kenichiro Iwasaki annotation1955563 1 O1 range1955563 1 49 74 annotation1955559 1 plac range1955559 1 20 74 annotation1955564 1 luxR binding site range1955564 1 1 19 annotation1955561 1 -10 range1955561 1 42 48 annotation1955562 1 O1 range1955562 1 27 41 annotation1955560 1 -35 range1955560 1 20 26 BBa_K182102 1 BBa_K182102 pLux-Lac with RBS attached 2009-07-06T11:00:00Z 2015-05-08T01:11:06Z BBa_I751502 and BBa_B0034) pLux-Lac hybrid promoter (BBa_I751502) upstream with RBS (BBa_B0034) attached downstream. false false _279_ 0 4115 9 It's complicated true N/A atm false Calum de Burgh and Zuzana Hruskova component2010165 1 BBa_B0034 component2010163 1 BBa_I751502 annotation2010165 1 BBa_B0034 range2010165 1 83 94 annotation2010163 1 BBa_I751502 range2010163 1 1 74 BBa_B0034_sequence 1 aaagaggagaaa BBa_K182102_sequence 1 acctgtaggatcgtacaggtttacttgtgagcggataacaatatagtgtgtggaattgtgagcggataacaatttactagagaaagaggagaaa BBa_I751502_sequence 1 acctgtaggatcgtacaggtttacttgtgagcggataacaatatagtgtgtggaattgtgagcggataacaatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z