BBa_K731721 1 BBa_K731721 T7 terminator 2012-08-14T11:00:00Z 2015-05-08T01:13:06Z We amplified it directly from pET21b. Released HQ 2013 This is a short terminator by T7phage that we tested with our new teminators' characterization system. false false _977_ 0 12063 9 In stock true This is a standard sequence, very used in many constructs. As i don't have any design considerations i can say that generally to make screening gels of such short segments is preferable to use TBE1X instead of TAE1X. false Giacomo Giacomelli, Anna Depetris annotation2180632 1 T7 terminator range2180632 1 1 48 BBa_K1823000 1 BBa_K1823000 EDE1C8 TEV scFv 2015-09-17T11:00:00Z 2015-09-18T12:08:07Z gene fragment synthesis EDE1C8 is one of broadly neutralize antibody for envelope glycoprotein of Dengue virus. This antibody this came from patients who infected by unknown serotype of Dengue virus,in silico experiment prove that the antibody can bind to all dengue virus envelope glycoprotein. To express this antibody in your choice host cell, such as E. coli, add the promoter and RBS on the upstream site. This part also has OsmY as a signal peptide that will bring the antibody to periplasm, so, it can be isolate by osmotic shock. You can collect the antibody by purification using Nickel column, it has Histidine (6X), and cut the target protein from another peptide using TEV protease. This scFv antibody has Myc as the linker between the light chain and heavy chain. true false _2249_ 25928 25928 9 In stock false OsmY, GSGG, Histidine (6X), TEV, vL, Myc, vH, terminator if you want to express the antibody, add the promoter and RBS false Isyatul Azizah component2469506 1 BBa_K731721 annotation2469506 1 BBa_K731721 range2469506 1 1 48 BBa_K731721_sequence 1 ctagcataaccccttggggcctctaaacgggtcttgaggggttttttg BBa_K1823000_sequence 1 ctagcataaccccttggggcctctaaacgggtcttgaggggttttttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z