BBa_K1824000 1 BBa_K1824000 Constitutive Promoter J23119 + RNA Thermometer A1 2015-09-03T11:00:00Z 2015-09-17T07:16:43Z J23119 was from the Registry, and A1 was from BIT-CHINA. This was a composite regulatory part that consisting of constitutive promoter J23119 and RNA Thermometer A1 for temperature induced gene expression at 42 degrees. A1 was derived from ROSE family (ROSE stands for Repression Of heat Shock gene Expression), first discovered in the 5′ untranslated region of rhizobial heat shock genes (Nocker, 2001). The possible secondary structure of A1 was simulated by RNAstructure (Fig.1). This combination was compatible with the assembly method that XJTLU-CHINA promoted. false false _2250_ 25787 25962 9 false The transcription of promoters always came with redundancy, which means the last few nucleic acids of the promoter can also be transcribed. it is important to make sure that those redundant sequences do not interact with RNA thermometers. false Wenbo Xu, Hao Wu component2443727 1 BBa_J23119 component2443728 1 BBa_K1824556 annotation2443728 1 BBa_K1824556 range2443728 1 36 77 annotation2443727 1 BBa_J23119 range2443727 1 1 35 BBa_J23119 1 BBa_J23119 constitutive promoter family member 2006-08-23T11:00:00Z 2015-08-31T04:08:40Z Overlap extension of synthetic oligonucleotides Released HQ 2013 Later false true _52_ 0 483 95 In stock false N/A true John Anderson BBa_K1824556 1 BBa_K1824556 RNA Thermometer A1 (Specially designed for J23119) 2015-09-03T11:00:00Z 2015-09-05T05:40:08Z the DNA sequence of A1 was from BIT-CHINA. A1 RNA thermometer was derived from the ROSE family (ROSE stands for Repression Of heat Shock gene Expression), first discovered in the 5′ untranslated region of rhizobial heat shock genes (Nocker, 2001). The possible secondary structure of A1 was simulated by RNAstructure (Fig.1). For testing results of A1 RNAT, See below. false false _2250_ 25962 25962 9 false To maintain the secondary structure of RNA thermometers, researchers need to be careful with of the use of any parts that couple with it. For instance, in some cases, part of operator region can be transcribed into RNAs and form tight secondary structure and thus interfere RNA thermometers. false Wenbo Xu BBa_K1824000_sequence 1 ttgacagctagctcagtcctaggtataatgctagctactagagctctttaaaaaaaaaaagtactaaggagtactag BBa_K1824556_sequence 1 acagagaacatactagagctctttaaaaaaaaaaagtactaaggagtactag BBa_J23119_sequence 1 ttgacagctagctcagtcctaggtataatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z