BBa_K1824562 1 BBa_K1824562 RNA Thermometer U6 (Specially designed for J23119) 2015-09-04T11:00:00Z 2015-09-05T11:04:26Z The DNA sequence of U6 was from registry. This is a specially designed U6 RNA thermometer that with a unique spacer at the front, which would make it compatible with promoter BBa_J23119. U6 RNA thermometer have the hairpin structure that harbors the Shine-Dalgarno sequence (SD sequence) and, in this way, make it inaccessible to the 30S unit of the bacterial ribosome, resulting in translational inactivation (Figure 2). The melting temperature of this RNA thermometer is 37 Celsius degree. Once reaching the melting temperature, hairpin structure would vanish and as a result, exposing the SD sequence to trigger the translation process. Different promoters have their own transcription start sites and, in most cases, + 1 sites are embedded in promoter sequence. Hence, it is normal that transcribed RNA usually carry part of promoter sequence. However, for regulatory parts like RNA thermometer, truncation or alteration of the RNA sequence could be destructive. Hence, special designed RNA spacer between transcribed part of promoters and RNA thermometers are important for maintaining the secondary structure of RNA thermometer. false false _2250_ 25962 25962 9 false To maintain the secondary structure of RNA thermometers, researchers need to be careful with of the use of any parts that couple with it. For instance, in some cases, part of operator region can be transcribed into RNAs and form tight secondary structure and thus interfere RNA thermometers. false Wenbo Xu BBa_J23119 1 BBa_J23119 constitutive promoter family member 2006-08-23T11:00:00Z 2015-08-31T04:08:40Z Overlap extension of synthetic oligonucleotides Released HQ 2013 Later false true _52_ 0 483 95 In stock false N/A true John Anderson BBa_K1824002 1 BBa_K1824002 Constitutive Promoter J23119 + RNA Thermometer U6 2015-09-04T11:00:00Z 2015-09-05T11:17:16Z J23119 and U6 were from the Registry. This is a composite regulatory part that consisting of constitutive promoter BBa_J23119 and RNA Thermometer U6 BBa_K1824562 for temperature induced gene expression at 37 degrees. The possible secondary structure of U6 was simulated by RNAstructure (Fig.1). This combination is compatible with the assembly method that XJTLU-CHINA promoted. false false _2250_ 25962 25962 9 false The transcription of promoters always came with redundancy, which means the last few nucleic acids of the promoter can also be transcribed. It is important to avoid truncation or alteration of the RNA sequence. false Wenbo Xu component2444202 1 BBa_K1824562 component2444201 1 BBa_J23119 annotation2444202 1 BBa_K1824562 range2444202 1 36 104 annotation2444201 1 BBa_J23119 range2444201 1 1 35 BBa_K1824562_sequence 1 atacagaacaggatcctctccttcactagtaaaaaaaaaaaaaaaaaaaaaaaaaaaggagatataccc BBa_J23119_sequence 1 ttgacagctagctcagtcctaggtataatgctagc BBa_K1824002_sequence 1 ttgacagctagctcagtcctaggtataatgctagcatacagaacaggatcctctccttcactagtaaaaaaaaaaaaaaaaaaaaaaaaaaaggagatataccc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z