BBa_K1824561 1 BBa_K1824561 RNA Thermometer FourU (Specially designed for T7) 2015-09-05T11:00:00Z 2015-09-06T05:30:05Z FourU was previously submitted by TuDelft 2008. This is a specially designed FourU RNA thermometer that with a unique spacer at the front, which would make it compatible with T7 BBa_I13453. FourU RNA thermometer have the hairpin structure that harbors the Shine-Dalgarno sequence (SD sequence) and, in this way, make it inaccessible to the 30S unit of the bacterial ribosome, resulting in translational inactivation (Figure 2). The melting temperature of this RNA thermometer is 37 Celsius degree. Once reaching the melting temperature, hairpin structure would vanish and as a result, exposing the SD sequence to trigger the translation process. false false _2250_ 25962 25962 9 false To maintain the secondary structure of RNA thermometers, researchers need to be careful with of the use of any parts that couple with it. For instance, in some cases, part of operator region can be transcribed into RNAs and form tight secondary structure and thus interfere RNA thermometers. false Wenbo Xu BBa_K1824007 1 BBa_K1824007 Consensus Promoter T7 + RNA Thermometer FourU 2015-09-05T11:00:00Z 2015-09-06T06:01:20Z FourU was previously submitted by TuDelft 2008 and T7 promoter was from registry This is a composite regulatory part that consisting of T7 promoter and RNA Thermometer FourU K1824561 for temperature induced gene expression at 37 degrees. The possible secondary structure of FourU was simulated by RNAstructure (Fig.1). This combination is compatible with the assembly method that XJTLU-CHINA promoted. false false _2250_ 25962 25962 9 false The transcription of promoters always came with redundancy, which means the last few nucleic acids of the promoter can also be transcribed. It is important to avoid truncation or alteration of the RNA sequence false Wenbo Xu component2445050 1 BBa_J64997 component2445051 1 BBa_K1824561 annotation2445050 1 BBa_J64997 range2445050 1 1 19 annotation2445051 1 BBa_K1824561 range2445051 1 20 85 BBa_J64997 1 BBa_J64997 T7 consensus -10 and rest 2007-03-25T11:00:00Z 2015-05-08T01:08:18Z false false _98_ 0 1428 98 Not in stock false false Sai Duriseti annotation1921746 1 T7-10 range1921746 1 1 19 BBa_J64997_sequence 1 taatacgactcactatagg BBa_K1824007_sequence 1 taatacgactcactataggtactagagggacaagcaatgcttgccttgaatagtaacttttgaatagtgattcaggaggtactag BBa_K1824561_sequence 1 tactagagggacaagcaatgcttgccttgaatagtaacttttgaatagtgattcaggaggtactag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z