BBa_K1824564 1 BBa_K1824564 RNA Thermometer U6 (Specially designed for T7) 2015-09-05T11:00:00Z 2015-09-06T06:26:15Z The DNA sequence of U6 was from registry. This is a specially designed U6 RNA thermometer that with a unique spacer at the front, which would make it compatible with promoter T7.It is important to noted that this part is not compatible with RFC[10]. XJTLU-CHINA used Gibson method to assembly this part to others. false false _2250_ 25962 25962 9 false To maintain the secondary structure of RNA thermometers, researchers need to be careful with of the use of any parts that couple with it. For instance, in some cases, part of operator region can be transcribed into RNAs and form tight secondary structure and thus interfere RNA thermometers. false Wenbo Xu BBa_I13453 1 BBa_I13453 Pbad promoter 2005-05-24T11:00:00Z 2015-08-31T04:07:34Z Released HQ 2013 PBad promoter from I0500 without AraC. false false _11_ 0 253 6 In stock false true jkm BBa_K1824008 1 BBa_K1824008 Consensus Promoter T7 + RNA Thermometer U6 2015-09-05T11:00:00Z 2015-09-06T06:33:57Z T7 promoter and U6 were from registry. This is a composite regulatory part that consisting of T7 promoter BBa_I13453 and RNA Thermometer U6 BBa_K1824564 for temperature induced gene expression at 37 degrees. The possible secondary structure of A1 was simulated by RNAstructure (Fig.1). This combination is compatible with the assembly method that XJTLU-CHINA promoted. false false _2250_ 25962 25962 9 false The transcription of promoters always came with redundancy, which means the last few nucleic acids of the promoter can also be transcribed. It is important to avoid truncation or alteration of the RNA sequence false Wenbo Xu component2445056 1 BBa_K1824564 component2445055 1 BBa_I13453 annotation2445055 1 BBa_I13453 range2445055 1 1 130 annotation2445056 1 BBa_K1824564 range2445056 1 131 199 BBa_I13453_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc BBa_K1824564_sequence 1 acagagaacaggatcctctccttcactagtaaaaaaaaaaaaaaaaaaaaaaaaaaaggagatataccc BBa_K1824008_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagcacagagaacaggatcctctccttcactagtaaaaaaaaaaaaaaaaaaaaaaaaaaaggagatataccc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z