BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_C0040 1 tetR tetracycline repressor from transposon Tn10 (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999) Released HQ 2013 Coding region for the TetR protein without the Ribosome Binding Site. Modified with an LVA tail for rapid degradation of the protein and faster fall time for the emission. TetR binds to the pTet regulator (BBa_R0040). aTc (anhydrotetracycline) binds to TetR and inhibits its operation.</P> false true _1_ 0 24 7 In stock false References (unparsed) here: <p>Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). </P> <p> Lutz R, Bujard H., Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. PMID: 9092630 </p> <P> References (unparsed) here: <p>Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). </P> <p> Lutz R, Bujard H., Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. PMID: 9092630 </p> <P>BBa_C0040 TetR Protein is based on the TetR sequence from Elowitz's repressilator. It has been modified to include a rapid degradation LVA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA. <P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman. annotation23329 1 tetR range23329 1 4 620 annotation2213989 1 Help:Barcodes range2213989 1 661 685 annotation23330 1 SsrA range23330 1 621 654 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_K1824104 1 BBa_K1824104 tet R+terminator 2015-09-14T11:00:00Z 2015-09-17T11:59:21Z NO Composed of tet R-rrnB terminator-T7 terminater, canbe used in further assembly. false false _2250_ 25787 24766 9 false NO false Hao Wu component2456335 1 BBa_K1824889 component2456338 1 BBa_B0012 component2456334 1 BBa_C0040 component2456336 1 BBa_B0010 annotation2456338 1 BBa_B0012 range2456338 1 798 838 annotation2456336 1 BBa_B0010 range2456336 1 710 789 annotation2456335 1 BBa_K1824889 range2456335 1 694 701 annotation2456334 1 BBa_C0040 range2456334 1 1 685 BBa_K1824889 1 BBa_K1824889 A Transcriptional Spacer Sequence 2015-09-05T11:00:00Z 2015-09-07T10:21:43Z E. coli promoter for tetracycline efflux protein gene Bacterial operator O2 for the tetR and tetA genes false false _2250_ 25962 25962 9 Not in stock false This is the second operator of pTet false Wenbo Xu BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1824104_sequence 1 atgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagtactagagtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_C0040_sequence 1 atgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1824889_sequence 1 tactagag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z