BBa_K1824555 1 BBa_K1824555 Site-directed mutated pLux that permits strong validity 2015-09-03T11:00:00Z 2015-09-04T11:31:30Z The DNA sequences of this part was provided by Haoqian Zhang, Peking University. This was a mutated pLux that permitted ideal ON/OFF ratio based on the original promoter Lux pR (BBa_R0062). BBa_R0062 was believed to have high constitutative expression in the absent of 3-oxo-hexanoyl-HSL and this problem went serious when regulatory promoter was coupled with toxins or other repression/activation parts. By using this mutated pLux, genetic circuits would be more easily to control and more sensitive to external signal change. false false _2250_ 25962 25962 9 false Due to the consideration of binding efficency of LuxR-AHL complex to the Lux box that embedded in pLux. Zhang only mutated -10 region of the original pLux. false Wenbo Xu annotation2443717 1 +1 range2443717 1 103 103 annotation2443714 1 -10 range2443714 1 92 97 annotation2443715 1 Lux Box range2443715 1 51 70 annotation2443718 1 Random Spacer range2443718 1 1 50 annotation2443716 1 -35 range2443716 1 70 75 BBa_K1824555_sequence 1 ttcgtcaggccacatagctttcttgttctgatcggaacgatcgttggctgacctgtaggatcgtacaggtttacgcaagaaaatggtttgttactttcgaataaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z