BBa_K1824561 1 BBa_K1824561 RNA Thermometer FourU (Specially designed for T7) 2015-09-05T11:00:00Z 2015-09-06T05:30:05Z FourU was previously submitted by TuDelft 2008. This is a specially designed FourU RNA thermometer that with a unique spacer at the front, which would make it compatible with T7 BBa_I13453. FourU RNA thermometer have the hairpin structure that harbors the Shine-Dalgarno sequence (SD sequence) and, in this way, make it inaccessible to the 30S unit of the bacterial ribosome, resulting in translational inactivation (Figure 2). The melting temperature of this RNA thermometer is 37 Celsius degree. Once reaching the melting temperature, hairpin structure would vanish and as a result, exposing the SD sequence to trigger the translation process. false false _2250_ 25962 25962 9 false To maintain the secondary structure of RNA thermometers, researchers need to be careful with of the use of any parts that couple with it. For instance, in some cases, part of operator region can be transcribed into RNAs and form tight secondary structure and thus interfere RNA thermometers. false Wenbo Xu BBa_K1824561_sequence 1 tactagagggacaagcaatgcttgccttgaatagtaacttttgaatagtgattcaggaggtactag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z