BBa_K1824893 1 BBa_K1824893 a strong promoter plus a strong RBS 2015-09-09T11:00:00Z 2015-09-11T08:37:07Z J23119 is from a constitutive promoter family and B0034 is based on Elowitz repressilator. A regulatory part composed of a strong promoter and a strong RBS, which can be used in both transcription and translation. Just add any protein after it. false false _2250_ 26000 26000 9 false No special concern false Xinhao Wang component2450242 1 BBa_B0034 component2450240 1 BBa_K1824889 component2450243 1 BBa_K1824890 component2450239 1 BBa_J23119 annotation2450243 1 BBa_K1824890 range2450243 1 56 61 annotation2450240 1 BBa_K1824889 range2450240 1 36 43 annotation2450239 1 BBa_J23119 range2450239 1 1 35 annotation2450242 1 BBa_B0034 range2450242 1 44 55 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J23119 1 BBa_J23119 constitutive promoter family member 2006-08-23T11:00:00Z 2015-08-31T04:08:40Z Overlap extension of synthetic oligonucleotides Released HQ 2013 Later false true _52_ 0 483 95 In stock false N/A true John Anderson BBa_K1824890 1 BBa_K1824890 The Sequence of the SpeI/XbaI scar in BioBricks standard assembly. 2015-09-06T11:00:00Z 2015-09-07T10:05:29Z It is the scar sequence of 3A assembly. In most cases, designers usually tend to embedded an appropriate spacer sequence between one individual part and the other. The 3A assembly, a commonly used manipulation method, creating scar between biobricks and, this unique scar usually served as default transcription spacer sequence. XJTLU-CHINA 2015 used Gibson assembly instead of conventional 3A assembly to create complex parts. If the reader have any interest to read the assembly diagram that the team promoted, they would find out that Gibson assembly was the ideal choices for the project. Though XJTLU-CHINA used Gibson assembly, which means parts could directly attach to one another without scars, the team still persevered the usually used scar sequence as the spacer. If readers looked through the assembly diagram that the team provided, they would find out that, for the constructs like a promoter part + a RBS part, the team not only embedded the spacer between the promoter and the RBS but also attach a spacer at the end of the RBS part. If the readers know the mechanism of Gibson assembly, they would know that it is for the one of the greatest feature of Gibson assembly, scarless manipulation. However, this design became problematical when the team registry the parts. Take the mentioned a promoter part + a RBS part as a instance, a promoter + a RBS Is usually registered as a composite part. What designers usually do is to enter part number they used in order and generate the new composite part with scars. Nevertheless, for the parts of XJTLU-CHINA, this operation is not applicable because if a promoter part + a RBS part was outputted as a new composite part with scars, there would be no scar remained at the end of RBS part. To fix this problem, we have to registry several spacer parts and put them into our composite parts in the manner of generating blunt end. false false _2250_ 25962 25962 9 false It part is unnecessary for the teams that use 3A assembly. false Wenbo Xu BBa_K1824889 1 BBa_K1824889 A Transcriptional Spacer Sequence 2015-09-05T11:00:00Z 2015-09-07T10:21:43Z E. coli promoter for tetracycline efflux protein gene Bacterial operator O2 for the tetR and tetA genes false false _2250_ 25962 25962 9 Not in stock false This is the second operator of pTet false Wenbo Xu BBa_K1824893_sequence 1 ttgacagctagctcagtcctaggtataatgctagctactagagaaagaggagaaatactag BBa_B0034_sequence 1 aaagaggagaaa BBa_K1824890_sequence 1 tactag BBa_K1824889_sequence 1 tactagag BBa_J23119_sequence 1 ttgacagctagctcagtcctaggtataatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z