BBa_K1825000 1 UNIK Antif UNIK antifreeze protein 2015-08-30T11:00:00Z 2016-01-27T10:30:03Z The part is taken from a spruce budworm, Choristoneura fumiferana, living in areas with permafrost. This is the coding region of a small antifreeze protein. It works by binding to the ice crystals as they form inside the cell, and by doing so prevents the ice crystals from enlarging and penetrating the cell membrane. We wanted to test if there would be a significant difference in the growth rate of moss, Physcomitrella patens, with the antifreeze gene, compared to the one without. This would be done at a low temperature to test the in-vivo function of the antifreeze protein. false false _2251_ 4206 28032 9 false We used codon optimization for moss so it would work better in Physcomitrella Patens. false Adam Petersen annotation2440844 1 startcodon range2440844 1 1 3 BBa_K1825000_sequence 1 atgaagtgcttgatgcttattatggccctggcgatcatcaacactgttagctcggacggctcgtgcactaacaccaacagtcagctctcagctaactccaagtgcgagaagtcgacgctaaccaactgctacgtcgacaagtccgaggtctatggtaccacttgcacgggtagccgatttgacggtgtgactattacgacgagcacctccactggttctcgtatctctggtcccggctgcaagatctctacatgcatcatcactggcggggtgcctgccccttcggccgcgtgcaagatctccggttgtactttcagcgctaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z