BBa_K1826001 1 BBa_K1826001 The part encodes the bacteriocin bactofencinA 2015-09-17T11:00:00Z 2015-09-18T05:17:50Z The sequence was directly ordered from IDT Bactofencin A is a cationic bacteriocin produced by Lactobacillus salivarius. When cloned downstream of a promoter, it expresses vbactofencin A upon induction. false false _2252_ 25967 25967 9 false - false Jayaprakash S annotation2474311 1 bactofencinA range2474311 1 1 162 BBa_K1826001_sequence 1 atgttttttaactttatgaaaaaagtggatgtgaaaaaaaactttggctataaagaagtgagccgcaaagatctggcgaaagtgaacggcggcaaacgcaaaaaacatcgctgccgcgtgtataacaacggcatgccgaccggcatgtatcgctggtgctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z