BBa_K1826002 1 BBa_K1826002 Bacteriocin Thuricin S 2015-09-17T11:00:00Z 2015-09-18T05:26:43Z The part was obtained from IDT as gBlocks. Thuricin S is a very small peptide bacteriocin of only 18 bp. It is naturally produced by Bacillus thuringiensis. It is active against a variety of organisms like Pseudomaonas aeruginosa, Listeria monocytogenes, Bacillus subtilis etc. false false _2252_ 25967 25967 9 false - false Jayaprakash S annotation2474410 1 thuricinS range2474410 1 1 60 BBa_K1826002_sequence 1 atggattggaccggctggagcggtctggtggtggcggcgtgcagcgtggaactgctgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z