BBa_K1826005 1 RNAcj RNA thermometer + cjBlue 2016-10-04T11:00:00Z 2016-10-05T06:55:11Z The cjBlue , green chromoprotein is from the Cnidopus japonicus sea anemone. RNA thermometer is from Bradyrhizobium japonicum that initiates translation at 42??C. This part is a composite of RNA thermometer and cjBlue, green chromoprotein. The RNA thermometer is an untranslated RNA sequence that will allow translation only above 42??C. Below this temperature, the RNA thermometer sequence will fold into a complex structure and prevent translation. The cjBlue , green chromoprotein is from the Cnidopus japonicus sea anemone. It naturally exhibits dark green color when expressed. The cjBlue protein is readily expressed in E.coli. The cjBlue acts as a reporter gene and the RNA thermometer, as a temperature controlled switch. true false _2252_ 27883 27883 9 true Since the RNA thermometer sequence was too small, we had to keep it in its backbone and ligate cjBlue to it. false Saishreyas Gourishankar Iyer component2486017 1 BBa_K592011 component2486015 1 BBa_K115001 annotation2486015 1 BBa_K115001 range2486015 1 1 96 annotation2486017 1 BBa_K592011 range2486017 1 103 804 BBa_K592011 1 cjBlue cjBlue, green chromoprotein 2011-09-17T11:00:00Z 2015-05-08T01:12:49Z Cnidopus japonicus This chromoprotein, cjBlue, naturally exhibits strong green/blue color when expressed. Compared to amilCP(BBa_K592009) and amilGFP(BBa_K592010), the color development is slower. On agar plates and in liquid culture, the color is readily visible to naked eye after 24-48 hours of incubation. The DNA was codon-optimized for expression in E.coli and synthesized by the Korean company Bioneer Corporation. false false _763_ 0 7929 9 In stock false Codon-optimization for expression in E.coli necessary. false Antonio Ascue Avalos annotation2131787 1 cjBlue range2131787 1 1 699 BBa_K115001 1 BBa_K115001 RNA thermometer (ROSE) 2008-07-14T11:00:00Z 2015-05-08T01:09:27Z This sequence is taken from the Bradirhizobium Japonicum (BA000040.) as the 5'UTR (ROSE) of a heat shock protein (prfA). Released HQ 2013 This part is designed as a temperature inducible RBS. Only designed so far. false false _223_ 0 3007 9 In stock true The secondary structure is important to the function of these regions, but part of the wt secondary structure is destroyed by the scar. We've tried to alter the sequence so the predicted structure (through mfold and those kind of servers) is sort of conserved, but temperature sensitivity still has to be tested. If it doesn't work, possible solution might be the addition of a larger conserved part of the wt, which implies a small part of wt protein sequence as well. true O.M.J.A. Stassen annotation1966927 1 Predicted Stem Loop range1966927 1 16 36 annotation1966928 1 Predicted Stem Loop range1966928 1 39 71 annotation1966929 1 Predicted Stem Loop extending to startcodon range1966929 1 72 96 annotation1966926 1 Predicted Stem Loop range1966926 1 1 15 annotation1966896 1 SD range1966896 1 90 95 annotation1966898 1 Biobrick-Scar-adaptation range1966898 1 74 79 BBa_K115001_sequence 1 gccgcgacaagcggtccgggcgccctaggggcccggcggagacgggcgccggaggtgtccgacgcctgctcgtcaagttcttgctccttggaggat BBa_K592011_sequence 1 atggcttccaaaataagcgacaacgtacgtatcaaactgtatatggagggcacggttaataatcaccacttcatgtgtgaagcggagggtgagggcaagccatacgaaggaacgcagatggaaaacattaaagtgaccaaaggaggcccgctgccgttctcttttgatatcctgacgccgaactgccaatatggttctgtagccataaccaagtacacgtcggggattccggactattttaaacagtcattccctgaaggttttacctgggaaagaaccaccatttatgaagatggggcttatctgacaactcagcaggaaaccaaacttgatggaaattgcttagtctacaatattaaaatcctcggctgcaattttccccccaatggtcctgttatgcagaaaaaaacgcaaggctgggaaccatgttgcgagatgcgctatacacgtgatggtgtcttgtgcggtcagacattaatggcactgaaatgtgccgatgggaaccatctgacttgtcatctgcggactacttaccgatccaaaaaggcagcgaaggcgttgcaaatgccacctttccatttttcagaccatcgtccggaaattgtgaaggttagcgagaacggcacactgtttgagcagcacgaaagtagtgtggcacgctattgtcagacatgcccgagcaaacttggtcataattaataa BBa_K1826005_sequence 1 gccgcgacaagcggtccgggcgccctaggggcccggcggagacgggcgccggaggtgtccgacgcctgctcgtcaagttcttgctccttggaggattactagatggcttccaaaataagcgacaacgtacgtatcaaactgtatatggagggcacggttaataatcaccacttcatgtgtgaagcggagggtgagggcaagccatacgaaggaacgcagatggaaaacattaaagtgaccaaaggaggcccgctgccgttctcttttgatatcctgacgccgaactgccaatatggttctgtagccataaccaagtacacgtcggggattccggactattttaaacagtcattccctgaaggttttacctgggaaagaaccaccatttatgaagatggggcttatctgacaactcagcaggaaaccaaacttgatggaaattgcttagtctacaatattaaaatcctcggctgcaattttccccccaatggtcctgttatgcagaaaaaaacgcaaggctgggaaccatgttgcgagatgcgctatacacgtgatggtgtcttgtgcggtcagacattaatggcactgaaatgtgccgatgggaaccatctgacttgtcatctgcggactacttaccgatccaaaaaggcagcgaaggcgttgcaaatgccacctttccatttttcagaccatcgtccggaaattgtgaaggttagcgagaacggcacactgtttgagcagcacgaaagtagtgtggcacgctattgtcagacatgcccgagcaaacttggtcataattaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z