BBa_K1828991 1 BBa_K1828991 sgOri 2015-09-02T11:00:00Z 2015-09-03T10:28:34Z The target sequence for sgRNA comes from pMSP3535 plasmid sequence This part is the sgRNA designed for targeting origin of replication of pMSP3535. pMSP3535 is used for expression of genes in gram positive bacteria such as Streptococcus mutans using NICE expression system. pMSP3535 was kindly provided to Nazarbayev University by Dr.Gary Dunny' Lab, University of Minnesota false false _2254_ 20031 20031 9 false The design of sgRNA was done by using Nature protocols false Altynay Abdirakhmanova BBa_K1828900 1 BBa_K1828900 Ptet+sgRNA for ori 2015-09-08T11:00:00Z 2015-09-09T12:36:50Z The sequence of sgRNA was designed to halt replication of plasmid pMSP3535 This composite part was designed to be a part of Blue Light Safety system that targets origin of replication of pMSP3535 plasmid. This plasmid works in gram positive bacteria and uses nisin controlled expression system (NICE).sgRNA targets a region of pMSP3535 that codifies for RebD. RebD is a protein that initiates replication. sgRNA is under TetR repressible promoter. pMSP3535 was kindly provided to Nazarbayev University by Dr.Gary Dunny's Lab, University of Minnesota false false _2254_ 20031 20031 9 false The design for sgRNA was done according to the Nature protocols false Altynay Abdirakhmanova component2447945 1 BBa_R0040 component2447950 1 BBa_K1828991 annotation2447945 1 BBa_R0040 range2447945 1 1 54 annotation2447950 1 BBa_K1828991 range2447950 1 63 165 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986785 1 -35 range1986785 1 20 25 annotation1986783 1 TetR 1 range1986783 1 1 19 BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K1828900_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaataggttgtttaattaactgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt BBa_K1828991_sequence 1 aataggttgtttaattaactgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z