BBa_K1828999 1 BBa_K1828999 nlmAB promoter 2015-09-02T11:00:00Z 2015-09-03T09:35:09Z It comes from genomic sequence of Streptococcus mutans nlmAB promoter is a natural promoter found in Streptococcus mutans. This promoter is upregulated by addition of Competence Stimulating Peptide (CSP) false false _2254_ 20031 20031 9 false There are no special design considerations false Altynay Abdirakhmanova BBa_K1828990 1 BBa_K1828990 sgVicK 2015-09-02T11:00:00Z 2015-09-03T10:01:02Z The sequence of VicK comes from genomic sequence of S.mutans. While, sgRNA for VicK was designed using Nature protocol for sgRNA design This part is a sgRNA for VicK. VicK was found to be responsible for lactic acid production and acid tolerance os Streptoccoccus mutans. sgRNA for VicK is designed to specifically target VicK in the genome of S.mutans with deadCas9 that does not have endonuclease activity. false false _2254_ 20031 20031 9 false sgRNA for VicK was designed for non-coding strandd of DNA false Altynay Abdirakhmanova BBa_K1828901 1 BBa_K1828901 PnlmAB+sgRNA for VicK 2015-09-08T11:00:00Z 2015-09-09T12:50:36Z nlmAB promoter sequence is a genomic sequence of S.mutans. This composite part consists form nlmAB promoter and sequence for sgRNA for VicK. nlmAB promoter is a natural promoter found in Streptococcus mutans. This promoter is upregulated by addition of Competence Stimulating Peptide (CSP). VicK was found to be responsible for lactic acid production and acid tolerance of Streptoccoccus mutans. sgRNA for VicK is designed to specifically target VicK in the genome of S.mutans with deadCas9 that lack endonuclease activity. false false _2254_ 20031 20031 9 false Design of sgRNA for VicK was done according to the Nature protocol false Altynay Abdirakhmanova component2447955 1 BBa_K1828990 component2447954 1 BBa_K1828999 annotation2447954 1 BBa_K1828999 range2447954 1 1 121 annotation2447955 1 BBa_K1828990 range2447955 1 130 232 BBa_K1828999_sequence 1 aaattagctggtaatgatagtttcagaacatcaaaaatgaccgtttaagacaaaatagctaccatttaggatattttgctctattttgaaaataaattgttatactaaagatgttggttgc BBa_K1828990_sequence 1 ccaaattttcatgcgttaaagttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt BBa_K1828901_sequence 1 aaattagctggtaatgatagtttcagaacatcaaaaatgaccgtttaagacaaaatagctaccatttaggatattttgctctattttgaaaataaattgttatactaaagatgttggttgctactagagccaaattttcatgcgttaaagttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z