BBa_K1828990 1 BBa_K1828990 sgVicK 2015-09-02T11:00:00Z 2015-09-03T10:01:02Z The sequence of VicK comes from genomic sequence of S.mutans. While, sgRNA for VicK was designed using Nature protocol for sgRNA design This part is a sgRNA for VicK. VicK was found to be responsible for lactic acid production and acid tolerance os Streptoccoccus mutans. sgRNA for VicK is designed to specifically target VicK in the genome of S.mutans with deadCas9 that does not have endonuclease activity. false false _2254_ 20031 20031 9 false sgRNA for VicK was designed for non-coding strandd of DNA false Altynay Abdirakhmanova BBa_K1828990_sequence 1 ccaaattttcatgcgttaaagttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z