BBa_K1829001 1 pBar1 pBar1: Mating factor alpha responsive promoter 2015-09-07T11:00:00Z 2015-09-14T11:39:47Z pBar1 is found in the genomic sequence of MATa S. cerevisiae. The pBar1 promoter is a mating factor alpha responsive promoter found in MATa S. Cerevisiae. This promoter drives expression of Bar1, a protease that cleaves mating factor alpha. false false _2255_ 18557 27842 9 false We changed nucleotide 210 from thymine to cytosine. This does not change the amino acid Asparagine and is therefore a silent mutation. We also changed nucleotide 285 from cytosine to adenine. This does not change the amino acid valine and is therefore a silent mutation. false Nicholas Suen BBa_K1829001_sequence 1 ctgtttttctacctccgacatcatgctgaaacatggcatgtaattaccgtaaaaggaaattacatggcgagtgtcacataatagcgacaataacatgtatacacagccagctattctgaaacacaccacattatagttattgaatgtgtgtgttttttgataacagtataaaagtgaagagaaagcacgtcgagccttgtcatgatgaactctttaatgatcttcgcgtgatttaattctagtggttcgtatcgcctaaaatcataccaaaataaaaagagtgtatagaagggtcatataatgtctgcaattaatcatctttgtttgaaacttattttggcgagtttcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z