BBa_K1831001 1 BBa_K1831001 TypeIII and AFP E-coil fusion + His tag 2015-08-31T11:00:00Z 2016-01-27T10:38:57Z The TypeIII AFP (PDB: 1AME) was obtained from Dr. Peter Davies lab at Queen's University. The E-coil was a novel sequence based off the E-coil (BBa_K1189012) and K-coil (BBa_K1189013) pair designed by Team Calgary 2013 This BioBrick is a fusion protein consisting of the ???E??? coil domain of our coiled-coil system fused in-frame to the C-terminus of a Type III AFP. Type III AFP (PDB fIle: 1AME) is a moderately active antifreeze protein from the ocean pout, with a small (7Kb), globular structure. The ???E??? coil refers to the coiled-coil with glutamic acid residues in the ???e??? and ???g??? positions of the helical wheel first used by Team Calgary 2013 (BBa_K1189011). There is a His-tag at the C-terminus of the ???E??? coil which provides an alternative purification method to ice-affinity. The fusion of the ???E??? coil to the Type III AFP will enable non-covalent, yet high affinity, specific attachment of AFPs to our protein scaffold and ???K??? coil BioBrick (BBa_K1831002). The interaction between the ???E??? and ???K??? coils involved oppositely charged residues, promoting the heterodimeric interaction of the coils that links AFPs to our scaffold. The addition of a His-tag to the C-terminus of the coil will allow for simple purification of the protein even for teams without access to an ice-affinity purification apparatus. false false _2257_ 4206 27228 9 false The TypeIII AFP was fused in-frame to the E-coil through a gly-ser linker. The gly-ser coding DNA used the specific codons for a BamHI site, which is a unique cut site not found in either the AFP, E-coil, or the pSB1C3 backbone. Thus if you require the part in a different backbone, simple confirmation on cloning by a single restriction digest is possible. false Malak Elbatarny, Joanna Semrau, Justine Ring, Morgan Litschko annotation2449964 1 E-coil range2449964 1 268 330 annotation2449961 1 T7 rbs range2449961 1 1 61 annotation2449963 1 TypeIII AFP range2449963 1 68 267 annotation2449967 1 XhoI site range2449967 1 358 363 annotation2449965 1 BamHI site range2449965 1 331 336 annotation2449962 1 NdeI site range2449962 1 62 67 annotation2450033 1 stop x2 range2450033 1 352 357 annotation2449966 1 His-tag range2449966 1 337 351 BBa_K1831001_sequence 1 tgtaagtttatacataggcgagtactctgttatggtccagagaaagaggggacaaaccagtcatatggcggcgaaccaggcgagcgtggtggcgaaccagctgattccgattaacaccgcgctgaccctggtgatgatgcgcagcgaagtggtgaccccggtgggcattccggcggaagatattccgcgcctggtgagcatgaggtgaaccgcgcggtgccgctgggcaccaccctgatgccggatatggtgaaaggctatgcggcggaaattgcggcgctggaaaaagagatcgctgcgctggaaaaggaaattgcggccctggagaagggatcccatcatcatcatcattaataactcgag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z