BBa_K1831002 1 BBa_K1831002 T3-10 Self-Assembling Scaffold with K-coil & His tag 2015-09-10T11:00:00Z 2015-09-26T08:08:01Z This part contains the sequence for the T3-10 subunit (PDB file 4EGG) which was computationally designed by Neil P. King of the Todd O. Yeates & David Baker lab (www.sciencemag.org/cgi/content/full/336/6085/1171/DC1) A single subunit of the T3-10 self-assembling protein scaffold (Baker 2008) is fused in-frame to the K=coil from Team Calgary 2013???s parallel coiled-coil proteins (BBa_K1189010). The ???K??? denotes the charged lysine residues in the ???e??? and ???g??? positions of the helical wheel representation of the coils. A His-tag fused to the C-terminus of the coils allows quick purification. The flexible linker Gly-Ser between the K-coil and the His-tag prevents potential electrostatic interference between the two domains. This fusion of the K-coil to each individual subunit means that once assembled into a multimer, multiple proteins with a complementary E-coil domain (such as our Type III AFPs: BBa_K1831001, BBa_K1831003) can be non-covalently attached to the scaffold. false false _2257_ 27229 27228 9 false The K-coil was created as an in-frame fusion protein, added to the C-terminus of the T3-10 subunit. By adding a flexible linker of Gly-Ser, between the scaffold and the coil, we incorporated a unique BamHI restriction site into the DNA sequence. This acts as a diagnostic marker for simplified cloning of our BioBrick into the expression vector of your choosing. false Morgan Litschko, Malak Elbatarny, Joanna Semrau, Justine Ring annotation2449952 1 XhoI site range2449952 1 755 760 annotation2449950 1 734 range2449950 1 734 748 annotation2449947 1 T3-10 subunit range2449947 1 68 664 annotation2449948 1 K-coil range2449948 1 665 727 annotation2449945 1 T7 promoter + RBS range2449945 1 1 61 annotation2449951 1 stop x2 range2449951 1 749 754 annotation2449949 1 BamHI Site range2449949 1 728 733 annotation2449946 1 NdeI site range2449946 1 62 67 BBa_K1831002_sequence 1 tgtaagtttatacataggcgagtactctgttatggtccagagaaagaggggacaaaccagtcatatgatgaccgaaaaagaaaaaatgctggcggaaaaatggtatgatgcgaactttgatcagaccctgattaacgaacgcctgcgcgcgaaagtgatttgctttgcgctgaaccataccaacccggtggcgaccatgatgcgcaaagtgctgattgatgcgctgtttcagaccaccaccgataacgtgagcattagcattccgtttgataccgattatggctggaacgtgaaactgggcaaaaacgtgtatgtgaacaccaactgctattttatggatggcggccagattaccattggcgataacgtgtttattggcccgaactgcggcttttataccgcgacccatccgctgaactttcatcatcgcaacgaaggctttgaaaaagcgggcccgattcatattggcagcaacacctggtttggcggccatgtggcggtgctgccgggcgtgaccattggcgaaggcagcgtgattggcgcgggcagcgtggtgaccaaagatattccgccgcatagcctggcggtgggcaacccgtgcaaagtggtgcgcaaaattgataacgatctgccgagcgaaaccctgaacgatgaaaccattaaaaagatcgcagccctgaaggaaaagattgccgcacttaaagagaaaatcgctgcgctcaaagagggatcccatcatcatcatcattaataactcgag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z