BBa_K1831003 1 BBa_K1831003 Type III AFP with E-coil 2015-09-10T11:00:00Z 2016-01-27T10:39:40Z The TypeIII AFP (PDB: 1AME) was obtained from Dr. Peter Davies lab at Queen's University. The E-coil was a novel sequence based off the E-coil (BBa_K1189012) and K-coil (BBa_K1189013) pair designed by Team Calgary 2013 What: This BioBrick is a fusion protein consisting of the E-coil domain of our coiled-coil system fused in-frame to the C-terminus of a Type III AFP. Type III AFP (PDB fIle: 1AME) is a moderately active antifreeze protein from the ocean pout, with a small (7Kb), globular structure. The E-coil refers to the coiled-coil with glutamic acid residues in the ???e??? and ???g??? positions of the helical wheel first used by Team Calgary 2013 (BBa_K1189011). This protein has been shown to be purified effectively by ice-affinity. If a His-tag is required for your purposes, see (BBa_K1831001). Why: The fusion of the E-coil to the Type III AFP will enable non-covalent, yet high affinity, specific attachment of AFPs to our protein scaffold and ???K??? coil BioBrick (BBa_K1831002). The interaction between the ???E??? and ???K??? coils involved oppositely charged residues, promoting the heterodimeric interaction of the coils that links AFPs to our scaffold. There is no His-tag, but ice-affinity purification can be used. By including a His-tag on our K-coil fusion protein (our scaffold: BBa_K1831002), and not the AFP with E-coil, we have enabled simple separation of any non-interacting coiled-coil domains. false false _2257_ 4206 27228 9 false The TypeIII AFP was fused in-frame to the E-coil through a gly-ser linker. The gly-ser coding DNA used the specific codons for a BamHI site, which is a unique cut site not found in either the AFP, E-coil, or the pSB1C3 backbone. Thus if you require the part in a different backbone, simple confirmation on cloning by a single restriction digest is possible. false Justine Ring, Morgan Litschko, Malak Elbatarny, Joanna Semrau, annotation2449990 1 Type III AFP range2449990 1 68 267 annotation2450055 1 XhoI site range2450055 1 343 348 annotation2449991 1 E-coil range2449991 1 268 330 annotation2449989 1 NdeI site range2449989 1 62 67 annotation2450054 1 stop x2 range2450054 1 337 342 annotation2449988 1 T7 rbs range2449988 1 1 61 annotation2449992 1 BamHI site range2449992 1 331 336 BBa_K1831003_sequence 1 tgtaagtttatacataggcgagtactctgttatggtccagagaaagaggggacaaaccagtcatatggcggcgaaccaggcgagcgtggtggcgaaccagctgattccgattaacaccgcgctgaccctggtgatgatgcgcagcgaagtggtgaccccggtgggcattccggcggaagatattccgcgcctggtgagcatgaggtgaaccgcgcggtgccgctgggcaccaccctgatgccggatatggtgaaaggctatgcggcggaaattgcggcgctggaaaaagagatcgctgcgctggaaaaggaaattgcggccctggagaagggatcctaataactcgag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z