BBa_K1833004 1 BBa_K1833004 lac promoter -> RpoA-N-terminus fused to Gal4 2015-09-15T11:00:00Z 2015-09-18T07:46:03Z The protein encoded by this part is used in the PNAS 2000 paper "A bacterial two-hybrid selection system for studying protein???DNA and protein???protein interactions," vol. 97, no. 13, pgs. 7382???7387. The part submitted to the registry was synthesized <I>de novo</I> and thus has a different nucleotide sequence, with the coding sequence codon optimized for E. coli. This part encodes the fusion protein consisting of the RpoA-N-terminus and Gal4. The part has a lacUV5 promoter, so the production of protein can be induced with IPTG in any E. coli strain. RpoA is the gene encoding the alpha subunit of E. coli RNA Polymerase, and the N-terminal domain is responsible for assembly of RNAP, while the C-terminal domain is responsible for recruiting the polymerase to DNA. This fusion protein is used as part of a bacterial two-hybrid system, where the Gal4 binds to Gal11P as in the yeast 2-hybrid system. false false _2259_ 27388 27388 9 false The part was designed with a lacUV5 promoter for simple induction that would not overwhelm the bacteria (as opposed to using a T7 promoter, which is often so active that it inhibits the cells from growing). false Konstantin Borisov annotation2463763 1 linker range2463763 1 848 856 annotation2463757 1 rbs range2463757 1 112 119 annotation2463762 1 RpoA amino acids 2-235 range2463762 1 146 847 annotation2463753 1 lac operator range2463753 1 37 57 annotation2463758 1 start range2463758 1 125 128 annotation2463769 1 terminator range2463769 1 983 1070 annotation2463768 1 stop range2463768 1 977 982 annotation2463761 1 6xHIS tag range2463761 1 129 145 annotation2463754 1 lac promoter range2463754 1 1 93 annotation2463766 1 Gal4 amino acids 58-97 range2463766 1 857 976 BBa_K1833004_sequence 1 tttacactttatgcttccggctcgtataatgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacggattcactggaactcgagaccaaagagaggacacaatgcatcatcatcatcaccatcaaggttcagtgacggagtttttaaaaccgcgcctggtggatatcgagcaagtttcttcgactcatgcgaaagtgacactggagccgctggaacgcggctttggtcacaccctggggaatgctctgcgtcggatcctgctgtcgtcaatgcccgggtgtgcggttacggaagtggaaatcgatggcgttcttcacgagtacagcaccaaagaaggcgttcaggaggacatcctcgaaatcctgctcaatctcaaaggactggcagtgcgcgttcagggtaaagatgaagtgattttaacccttaataaatcgggcattggcccggtaacagcggcggatatcacgcatgacggtgatgtcgaaatcgtaaagccgcagcatgtaatttgtcacctcacagatgaaaacgcctcaatctctatgcgcatcaaagtacagcggggtcgtggttacgtcccggcgagcactcgtatccatagcgaagaggacgaacgtccgattgggcgtctgctggtcgatgcgtgttattcacctgtcgaacgcatcgcctacaatgtagaggcggcgcgtgtagaacaacgcacggatctggacaaactggtcatcgaaatggaaacaaatggaaccatcgatccagaagaggccattcgtcgtgccgcgacgatcttggcggaacaacttgaagcttttgtggacctgcgggcggctgccgaatcacgtctggaacgcctggaacaactgttcctgctcatttttccgcgcgaggaccttgacatgatcctgaaaatggactccctccaggatatcaaggcacttcttacaggcctgttctaatagtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcgtcgac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z