BBa_K1833005 1 BBa_K1833005 pT7-Phage 434 repressor N-terminus 2015-09-15T11:00:00Z 2015-09-18T07:42:02Z Uniprot This is the DNA binding domain of the phage 434 repressor (UniProt). Without the C-terminus, it cannot dimerize and form the fully functional repressor. This part was used as a negative control for repression of a synthetic promoter. false false _2259_ 27388 27388 9 false we made it false Konstantin Borisov annotation2469060 1 pT7 range2469060 1 1 20 annotation2469062 1 434 cI N-terminus range2469062 1 33 344 annotation2469061 1 rbs range2469061 1 24 29 annotation2469063 1 T7 terminator range2469063 1 345 385 BBa_K1833005_sequence 1 taatacgactcactatagggaaagaggagaaaatgagcatctccagtcgtgtgaaaagcaaacggatccagttaggtttaaatcaagccgaactggcccagaaagttggcacgactcaacaaagcatcgagcagctcgaaaacggtaaaactaaacgcccccgttttctgccggaacttgccagtgctctgggcgttagcgttgactggcttttgaatggaactagcgacagcaacgtccgtttcgtagggcacgtagagcctaaagggaaatatccactcatttctatggttcgcgcaggttcatggtgcgaagcatgcgaaccgtacgatatcaaataatgaaaccccttggggcctctaaacgggtcttgaggggttttttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z