BBa_K1833006 1 BBa_K1833006 lac promoter -> Zinc finger 225 binding domain fused to Gal11P 2015-09-16T11:00:00Z 2015-09-16T11:17:20Z Joung, J. K. et. al. "A bacterial two-hybrid selection system for studying protein???DNA and protein???protein interactions," PNAS, 2000, vol. 97, no. 13. This part generates a fusion protein containing the Zif268 (Zinc finger 225 gene) DNA binding domain fused to Gal11P, as used in the yeast 2-hybrid system. This part can be used in combination with BBa_K1833004 to create an E. coli 2-hybrid system. With a promoter containing the Zif268 binding sequence, these two parts can combine to recruit RNA polymerase to a weak promoter, such as the one in BBa_K1833007. Such a system was used in Joung, J. K. et. al. "A bacterial two-hybrid selection system for studying protein???DNA and protein???protein interactions," PNAS, 2000, vol. 97, no. 13. false false _2259_ 27388 27388 9 false A nucleotide between the promoter and RBS had to be mutated to remove an illegal restriction site. false Konstantin Borisov BBa_K1833006_sequence 1 tttacactttatgcttccggctcgtataatgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacggattcactggaactcgagaccaaagagaggacacaatgccacagcaacaacaaatgcagccccctaattctagcgcagacaataacccactgcaacagcagagttcccagaatacggtgcctaatgttttaaatcagatcaatcagatctttagcccagaagaacagcgttctctgctccaggaagcgatcgaaacgtgcaaaaatttcgaaaaaacccagctcgggtccaccatgacagagccggtaaaacagtctttcattcgtaaatatatcgtacaaaaagcactgcgtaaaattcaagccctggccgccgcgccgagtaaaacaccgccgcatgaacgtccatatgcatgtccggtcgaaagctgcgaccggcgttttagtcgcagtgatgaattaacccgccacattcgcatccacacggggcaaaagccgttccaatgccgtatttgcatgcggaactttagtcgttccgaccacctgaccacacatattcgcacacataccggcgaaaaacctttcgcgtgcgatatttgcgggcgcaaattcgcacgtagtgacgagcgcaaacgccacaccaagatccatctgcgtcagtaatagtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z